BGI 5128 PDF

*Exchange rate ref. BCCR. The supplier can change the price of the product. Aeropost is an online shopping services provider. Total price includes all charges . NM_c+A>G; NM_c+A>T . ss, BGI|BGI_rs, fwd/B, C/T, aatggcaaaatgataaattgtggtcttctg. ss, BGI|BGI_rs, rev/B, G/T, ctgttgagtgaaggctgtgttcttggaggg, agtattctttgaataaactgatgaattcca, 06/06/08, 06/18/09, , Genomic, unknown.

Author: Goltinris Nikomi
Country: Zambia
Language: English (Spanish)
Genre: Sex
Published (Last): 18 December 2009
Pages: 441
PDF File Size: 7.28 Mb
ePub File Size: 6.10 Mb
ISBN: 160-9-44734-998-6
Downloads: 85892
Price: Free* [*Free Regsitration Required]
Uploader: Kigazil

R R R 528 R C ]; nitrite [CPD: Functional analysis of the small component of the 4-hydroxyphenylacetate 3-monooxygenase of Escherichia coli W: It furthers the University’s objective of excellence in research, scholarship, and education by publishing worldwide. Published by Oxford University Press. Availability of supporting data. Previously classified as 2-nitropropane dioxygenase EC 1.

A two-protein component enzyme. Kinetic evidence for an anion binding pocket in the active site of nitronate monooxygenase.

Preços referenciais B3 – prêmios de opções

Crystal structure of 2-nitropropane dioxygenase complexed with FMN and substrate. Using homology-based, de novo and transcriptome-based prediction methods, we predicted 20 protein-coding genes in the generated assembly, which is less than our previously reported gene number 23 of the tiger tail seahorse H.

  BADIOU INAESTHETICS PDF

In order to improve the aquaculture yield of this valuable fish species, we are trying to develop genomic resources for assistant selection in genetic breeding. Identification of the catalytic base.

Draft genome of the lined seahorse, Hippocampus erectus | GigaScience | Oxford Academic

The lined seahorse, Hippocampus erectusis an Atlantic species and mainly inhabits shallow sea beds or coral reefs. Oxidoreductases; Acting on single donors with incorporation of molecular oxygen oxygenases ; With incorporation of 1528 atom of oxygen internal monooxygenases or internal mixed-function oxidases.

C ]; O2 [CPD: Email alerts New issue alert. Involvement of a flavosemiquinone in the enzymatic oxidation of nitroalkanes catalyzed by 2-nitropropane dioxygenase. The enzymes 512 the fungus Neurospora crassa and the yeast Williopsis saturnus var. Sign In or Create an Account.

Active towards linear alkyl nitronates of lengths between 2 and 6 carbon atoms and, with lower activity, towards propylnitronate. Citing articles via Web of Science 2.

GigaScienceVolume 6, Issue 6, 1 Junegix, https: Biochim Biophys Acta Characterization of an Escherichia coli aromatic hydroxylase with a broad substrate range. Receive exclusive offers and updates from Oxford Academic.

The enzyme uses FADH2 as a substrate rather than a cofactor [4]. Re analyzing community-wide datasets without major infrastructure. Oxford University Press is a department of the University of Oxford. J Biol Chem ExplorEnz – The Enzyme Database: Close mobile search navigation Article navigation.

  ISO 4674-1 PDF

Bpet Bpet Bpet Bpet The enzyme from N. Characterization of bti anthranilate degradation pathway in Geobacillus thermodenitrificans NG Xun L, Sandvik ER. Draft genome of the lined seahorse, Hippocampus erectus Qiang Lin.

Sponsors of Barbados Gospelfest 2018 “Touching Lives Changing Nations”

Francis K, Gadda G. Oxidoreductases; Acting on paired donors, with incorporation or reduction of molecular oxygen; With reduced flavin or flavoprotein as one donor, and incorporation of one atom of oxygen into the other donor.

We report a draft genome of the lined seahorse. It has become very popular in China for its wide use in traditional Chinese medicine. NAD P H reductase subfamily.